Resources
Wasp collecting
We collect wasps using standard Drosophila traps, which can be set up in any number of ways (see "Drosophila: A Guide
to Species Identification and Use" by Markow and O'Grady). Any trap that attracts fruitflies is also likely to attract
parasitoid wasps looking for Drosophila hosts. Usually we use large tupperware containers with slits on the sides for fly
entry that are filled with rotting fruit. The wasps are small (~2mm) and look like mini ants with wings, and they can often be
found exploring the inside of rotting fruits for fruitfly larvae and pupae. Unlike flies, wasps rarely fly when the traps are
opened and are thus caught in nets infrequently. Instead, we catch them by aspirating them off the substrate into standard
Drosophila food vials for storage. In order to rear the wasps we catch (see below), we usually net whatever Drosophilids were
attracted to the same trap for use as hosts. We later try to move the new wasps onto one of the easy-to-rear and generally
susceptible fly species, like D. melanogaster or D. virlis.



Wasp rearing
Drosophila parasitoid wasps are pretty easy to rear in the lab. If you can rear Drosophila, you can rear their parasitoid wasps.
For larval parasitoids, we allow host flies to lay eggs in standard Drosophila food vials for two to three days until there are a
good number (>100) of fly eggs. We then remove the adult flies and replace them with adult wasps, using at least 5 female
wasps per vial. Figitid females can be distinguished from males by their much shorter antennae, while Braconid females have
obvious ovipositor sheaths projecting from the abdomens. The wasps usually attack the second instar fly larvae and will
complete their life cycles and eclose in 3-4 weeks at room temperature. For pupal parasitoids, we wait until fly larvae are at
wandering stage before adding wasps. Diapriid females can be distinguished from males by their much shorter antennae.
We've found that adding ~0.5mL of 50% honey water to the cotton tops of the Drosophila vials prolongs wasp lifespan. Wasps
can be treated just like flies, e.g. they can be knocked out with CO2 and can be maintained alive for long periods of time at 18
degrees C.

Wasp identification
We use "Hymenoptera of the world: An identification guide to families", edited by Goulet and Huber, to determine which
families new wasps belong to. For identification of Figitid wasps in the genus Leptopilina, we've found three papers
particularly useful (Nordlander 1980 EntScand, Allemand 2002 AnnSocEntomolFr, Novkovic 2011 EntomolSci). Keys for other
Drosophila parasitoids tend to be obscure and limited to particular species. We are developing a morphological key for the
wasps we have, but at present it's easiest to collect DNA sequence information for wasp species identification. We obtained
COI sequence for all our wasps as well as ITS2 sequence for the Figitids using the following PCR primers.
COI forward: ggtcaacaaatcataaagatattgg
COI reverse: taaacttcagggtgaccaaaaaatca
ITS2 forward: tgtgaactgcaggacacatg
ITS2 reverse: aatgcttaaatttagggggta
Genbank numbers for all sequences are listed on the phylogeny below, but you can download all our sequences in one shot
here. If you happen to catch some Drosophila parasitoids and aren't sure what they are, we would be happy to identify them
for you and possibly add them to our stock collection!



Wasp strains
We maintain a large number of live strains of parasitoid wasps that infect Drosophila. Our lab policy is to make these
strains available to everyone once we have published on them. The phylogeny below shows all the strains we currently
hold, most of which became available with our recent publication on wasp resistance in D. suzukii (Kacsoh and Schlenke
2012).

Fly transcriptional response to wasp infection
In 2007 we published a microarray study comparing the transcriptional responses of D. melanogaster to two different
parasitoid wasp species (Schlenke et al. 2007). The data were deposited in the Gene Expression Omnibus, accession number
GSE8938. However, for quick access to the data to check if your favorite fly gene was differentially expressed in our study,
please download this excel file of gene expression fold changes. In the file, bold numbers represent statistically significant
fold changes. "Lb-5" corresponds to fold expression change in fly larvae infected by the wasp L. boulardi, compared to
uninfected flies, five hours after infection. Likewise, "Lh-24"corresponds to fold expression change in fly larvae infected by the
wasp L. heterotoma, compared to uninfected flies, twenty four hours after infection. The "LbLh" values combine L. boulardi
and L. heterotoma infection data for comparison against uninfected fly data while the "Lb/Lh" values compare expression
between L. boulardi and L. heterotoma infected flies.

Wasp venom genes
In 2013 we published two papers describing a joint transcriptomic-proteomic approach for identifying parasitic wasp venom
genes (Goecks et al. 2013, Mortimer et al. 2013). The data were deposited in various databases, including in GenBank for
assembled wasp transcripts (Transcriptome Shotgun Assembly accession numbers GAIW00000000, GAJA00000000,
GAJC00000000). For quick access to the lists of venom-specific transcripts and protein sequences from the three wasp
species, please download the following Fasta files for the wasps L. boulardi (cDNA, protein), L. heterotoma (cDNA, protein),
and Ganaspis sp.1 (cDNA, protein). The cDNA sequences in these files are the female wasp abdomen transcript contigs that
were "hit" by peptide sequences collected from the lumens of female wasp venom glands,while the protein sequences are
the translated ORFs from the wasp transcripts that were hit by the the venom peptides.
